Frequencies of Restriction Sites

The table below summarizes the frequencies with which restriction endonuclease sites occur in commonly used DNA molecules. Detailed restriction maps can be found on DNA sequences and maps. The sites listed in these tables were identified by computer analysis of published sequences. Although we have tried to ensure their accuracy, the sites have not necessarily been confirmed by experimentation. When the same specificity is displayed by several enzymes, the site is listed by the name of the enzyme that is available from New England Biolabs. Other enzymes with the same specificity are listed in the table of isoschizomers. Recognition sequences are written 5´ to 3´.

DNASU is a central repository for plasmid clones and collections that may also be helpful.

Enzyme Recognition Sequence Adeno-2 Lambda M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI CNNNNNNNNNNN/NNNNNNNNNG
Acc65I G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AccI GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
AciI CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AcuI CTGAAG(16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
AgeI § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AhdI GACNNN/NNGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 CACNN/NNGTG 10 20 1 0 1 0 1 0 2 0 8
AluI AG/CT 158 143 27 17 38 28 27 30 34 16 140
AlwI GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
ApaI GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
ApaLI G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
AseI AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
AvaI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
AvaII G/GWCC 73 35 1 8 7 9 6 6 8 2 54
AvrII C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 1 1 1 1 0
BanI G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
BanII GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF® GAAGAC(2/6) 24
BbvCI CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI GCAGC(8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI CCATC(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI GTATCC(6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI GTCTC(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI C/TAG 54 13 5 5 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII A/GATCT 11 6 1 0 1 1 2 0 2 0 1
BlpI GC/TNAGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI ACTGGG(5/4) 22 4 1 5 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI CTGGAG(16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI CTTGAG(16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI § GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaI-HF®v2 GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI W/CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI (9/12)ACNNNNNCTCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI GAGGAG(10/8) 63 19 1 0 2 0 3 0 0 0 13
BseYI CCCAGC(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI GTGCAG(16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF® C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI CCNNNNN/NNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI GTCTC(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
BsmFI GGGAC(10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrI ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 CACGAG(-5/-1)
BstAPI GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII  § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI R/GATCY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF® GTATAC 3 3 0 1
Bsu36I CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI GCGATG(10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI GGATG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20
BtsI-v2 GCAGTG(2/0)
Cac8I GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI GA/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 0 2 0 1 1 0 16
DrdI GACNNNN/NNGTC 6 3 1 2 5 2 2 4 4 2 11
EaeI Y/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI § C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
EagI-HF® C/GGCCG 19 2 0 1 4 1 2 2 0 0
EarI CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Eco53kI GAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I CAGCAG(25/27) 50 72 4 7 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 1 1 1 1 0
EcoRV § GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® GAT/ATC 9 21 0 1 1 1 1 3 0 0
Esp3I CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
FatI 183 181 14 26 38 23 21 23 31 11 148
FauI CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI GGATG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI CC(12/16)
FspI TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI GACGC(5/10) 87 102 7 11 10 12 7 20 15 4 70
HhaI GCG/C 375 215 26 31 36 39 41 46 17 103
HincII GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 1 0 2 1 0
HinfI G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV A/CGT 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
KasI G/GCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 0 0 0 0 1 1 5
LpnPI CCDG(10/14)
MboI /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 2 1 1 1 0 8
MluCI /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGCGT
MlyI GAGTC(5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI TCCRAC(20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
MscI TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
MseI T/TAA 115 195 63 15 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I CMG/CKG 95 75 4 6 14 11 8 10 12 6 35
MspI C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI CNNR(9/13)
MwoI GCNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
NaeI GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
NarI GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI 9 7 2 0 0 0 0 0 0 10
Nb.BsmI 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI 14 44 3 2 7 4 4 4 2 18
Nb.BssSI 11 8 0 3 5 3 2 4 3 31
Nb.BtsI 22 34 1 2 7 5 4 4 3 20
NciI CC/SGG 97 114 4 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 0 0 1 1 0 1 0 1
NdeI CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI § G/CTAGC 4 1 0 1 4 0 1 1 0 1
NheI-HF® G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII CATG/ 183 181 14 26 38 23 21 23 31 11 148
NlaIV GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
NotI § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA
NsiI § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T
NspI RCATG/Y 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI GTCTC(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
PacI TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PciI A/CATGT 9 2 3 1 3 1 2 1 1 1 6
PflFI GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0
PleI GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI GGCGC/C
PmeI GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI CAC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
PshAI GACNN/NNGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI G/GGCCC 12 1 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 3 1 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 1 1 3 2 1 2 2 0
PvuII § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® CAG/CTG 24 15 3 1 3 3 3 4 2 3
RsaI GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 0 2 1 0 1 1 0
SacII CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 1 1 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 0 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexAI A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI TAC/GTA 0 1 1 0 1 0 1 0 0 0 13
SpeI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 1 1 2 0 2 1 1 0
SrfI GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 6 1 6 2 3 5 1 6
StuI AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI § C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
StyI-HF® C/CWWGG 44 10 0 1 4 1 2 4 0 36
SwaI ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TaqI-v2 T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI G/AWTC 32 87 18 6 14 4 5 5 10 2 103
TseI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
XmaI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZraI GAC/GTC 3 10 0 1 0 0 5 1 0 1 1

§ An HF version of this enzyme is available.

* For M13mp18, only double-stranded regions will be cut.
Loading Spinner