NEB_logo_reversed_tagline2 NEB_logo_tagline NEB_logo_mobile NEB_logo_reversed_mobile
  • Applications & Products Applications & Products
    • Applications

    • Supporting COVID-19 Research
    • Supporting Molecular Diagnostics
    • Cloning & Synthetic Biology
    • DNA Amplification, PCR and qPCR
    • Genome Editing
    • RNA Analysis
    • Sample Prep for NGS & Target Enrichment
    • Epigenetics
    • Protein Expression
    • Protein Purification
    • Protein Analysis & Tools
    • Glycobiology & Proteomics
    • Cellular Analysis
    • Product Categories

    • Restriction Endonucleases
    • PCR, qPCR & Amplification Technologies
    • DNA Modifying Enzymes
    • Sample Prep for NGS & Target Enrichment
    • Nucleic Acid Purification
    • Markers & Ladders
    • RNA Reagents
    • DNA Assembly, Cloning and Mutagenesis Kits
    • Genome Editing
    • Cellular Analysis
    • Epigenetics
    • Protein Expression & Purification Technologies
    • Competent Cells
    • Protein Tools
    • Glycobiology
    • DNA Plasmids
    • Buffers
    • Strains
    • Discontinued
    newNew Products
    newSamples & Special Offers
    COVID19_Megamenu_Icon_smallSupporting COVID-19 Research

    Are you doing COVID-19 related research? Our latest RUO kit, the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit, enables high throughput workflows for real-time detection of SARS-CoV-2 nucleic acid using hydrolysis probes. For simple, visual assay results, the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit includes a color-changing pH indicator for detection of SARS-CoV-2 nucleic acid amplification

    Learn about our tools that are helping researchers develop diagnostics and vaccines for the SARS-CoV-2 virus.

    Time for Change

    Monarch Nucleic Acid Purification Kits are optimized for maximum performance and minimal environmental impact. Kits are available for total RNA purification, plasmid miniprep, gel extraction, and DNA & RNA cleanup. For maximum convenience and value, columns and buffers are also available separately. Learn more and request a sample!

  • Tools & Resources Tools & Resources
    • Tools

    • Product Selection
    • Restriction Enzyme Tools
    • Primer Design Tools
    • Experimental Design
    • Calculators
    • Databases
    • Additional Tools
    • Resources

    • FAQs
    • Protocols
    • Selection Charts
    • Troubleshooting Guides
    • Usage Guidelines/Tips
    • Interactive Tools
    • Video Library
    • Web Tools
    • Webinars
    • Application Notes
    blog_megamenu_36x36NEBinspired Blog                 
    catalogOrder Catalog
  • Support Support
    • Technical Support
    • International Ordering & Support
    • New Lab/BioTech Discount
    • OEM & Customized Solutions
    • Catalog & Literature Request
    • Supporting Molecular Diagnostics
    • Supporting Infectious Disease Research & Development
    • Supporting COVID-19 Research
    • Supporting Biotech & Pharma
    • Promoting Science Education
    • Packaging & Shipping
    • Quality Assurance
    icon-cta-feedbackCustomer Suggestions & Feedback
  • About About
    • NEB Overview
    • News & Press Releases
    • Leadership
    • Research at NEB
    • Environmental Commitment
    • Social Responsibility & Sustainability
    • Quality at NEB
    • ISO Certification
    • Passion in Science Award
    • Business Development Opportunities
    • Careers
    • Contact Us
|
  • Sign In
  • Sign Up
Home FAQs What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument?

FAQ: What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument?

The NEBNext libraries for Illumina resemble TruSeq libraries and can be trimmed like TruSeq:

Adaptor Read1   AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Adaptor Read2   AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT   

Links to this resource

Related Products:
NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1),
NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 2),
NEBNext Multiplex Oligos for Illumina (Index Primers Set 3),
NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 4), NEBNext® Multiplex Oligos for Illumina® (96 Index Primers), NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1), NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2), NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs), NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs Set 2), NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs Set 3), NEBNext® Multiplex Oligos for Illumina® (96 x 96 Unique, Matched Dual Index Primers Set 4),

NEBNext® Multiplex Oligos for Enzymatic Methyl-seq Unique Dual Index Primer Pairs

,
NEBNext® Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors DNA Set 1), NEBNext® Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1), NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs Set 5)

To Request Technical Support

Fill out our Technical Support Form.

For Customers Outside of
this Region

Contact your local subsidiary or distributor.

Want to learn about new products?

Sign up for our eNewsletters

Support NEB Overview Contact Us Careers Site Map Terms of Use Trademarks Terms of Sale Privacy Cookie Policy
Certified B Corporation
© Copyright 2022 New England Biolabs. All Rights Reserved.

Choose your country

North America

Canada Canada USA United States

Europe

Austria Austria France France Germany Germany UK United Kingdom

Asia-Pacific

Australia Australia China China Japan Japan NewZealand New Zealand Singapore Singapore

If you don't see your country above, please visit our international site

Loading Spinner

Session Expired

You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.

Institution Changed

Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.

Sign in to your NEB account

To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.

Sign In