Home Next Generation Sequencing Library Preparation Products EpiMark® N6-Methyladenosine Enrichment Kit

EpiMark® N6-Methyladenosine Enrichment Kit
Epi

The Epimark® N6-Methyladenosine Enrichment Kit can be used to enrich m6A modified RNA in immunoprecipitation protocols for downstream analysis by next-generation RNA sequencing or RT-qPCR.

  • Complete protocol for enrichment of m6A-modified –RNA and analysis by RT- qPCR included
  • RNA controls (m6A modified and unmodified RNA) enable monitoring of enrichment and depletion
  • Antibody supplied in a ready-to-use solution form

Featured Video

RNase_Contamination_Anim_720x405

Avoiding RNase Contamination

Catalog # Concentration Size List Price Your Price Quantity
E1610S Not Applicable 20 reactions $489.00
Please enter a quantity for at least one size
  • The EpiMark N6-Methyladenosine Enrichment Kit contains a rabbit monoclonal antibody specific for N6-Methyladenosine (m6A). The kit also contains two control RNAs, one with m6A modification (Gaussia luciferase) and one without (Cypridina luciferase) to monitor enrichment and depletion. The GLuc RNA control was transcribed in the presence of 20% m6ATP and 80% ATP.
    This kit can be used to enrich m6A modified RNA in immunoprecipitation protocols for downstream analysis by next-generation RNA sequencing or RT-qPCR. Modified RNA is isolated from a fragmented RNA sample by binding to the N6-Methyladenosine antibody attached to Protein G Magnetic Beads. After multiple wash and clean-up steps, the enriched RNA is eluted in nuclease-free water and is ready for further analysis.

    Epimark N6-Methyladenosine Enrichment Kit Workflow
    Figure 1. Workflow

    Each kit contains sufficient reagents to perform 10 x 2-round immunoprecipitations with starting amounts of up to 250 µg of ribosome depleted or poly A+ purified RNA. It contains sufficient reagents for 5 x 2-round immunoprecipitations when using up to 250 µg of total RNA.
    This product is related to the following categories:
    Methylome Analysis Products,
    RNA Modification,
    Next Generation Sequencing Library Preparation Products

    • Kit Components

      The following reagents are supplied with this product:

      NEB # Component Name Component # Stored at (°C) Amount Concentration
      • E1610S     -20    
          N6-Methyladenosine Antibody E1611AVIAL -20 1 x 0.02 ml 20 reactions
          m6A Control RNA N1611AVIAL -20 1 x 0.02 ml 100 nM
          Unmodified Control RNA N1612AVIAL -20 1 x 0.02 ml 100 nM

    • Properties & Usage

      Materials Required but not Supplied

      Reaction Buffer
      (150 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% NP-40 in nuclease free H2O)

      Low Salt Reaction Buffer
      (50 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% NP-40 in nuclease free H2O)

      High Salt Reaction Buffer
      (500 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% NP-40 in nuclease free H2O)

      Protein G Magnetic Beads (NEB #S1430)

      Magnetic Racks for bead separations (NEB #S1506 or #S1509)

      Dynabeads® MyOne™ Silane (Life Technologies #37002D)

      Buffer RLT (Qiagen #79216)

      100% Ethanol

      70% Ethanol

      Eppendorf® RNA/DNA LoBind microcentrifuge tubes (Sigma catalog #Z666548) or equivalent

      RNase-free pipette tips

      Powder-free gloves

      Nuclease-free water


      Optional Materials
      Primers for amplification of control RNAs:
      GLuc Forward Primer = 5´- CGACATTCCTGAGATTCCTGG - 3´
      GLuc Reverse Primer = 5´- TTGAGCAGGTCAGAACACTG - 3´
      CLuc Forward Primer = 5´- GCTTCAACATCACCGTCATTG - 3´
      CLuc Reverse Primer = 5´- CACAGAGGCCAGAGATCATTC - 3´

      ProtoScript® II First Strand cDNA Synthesis Kit (NEB #E6560)

      Bio-Rad iTaq™ Universal SYBR® Green Supermix (cat. #172-5120)

      384 well PCR plate (Bio-Rad cat. #HSP-3805)
       
      Optical film (Bio-Rad cat. #MSB-1001)

    • Related Products

      Companion Products

    • References

      1. Schwartz, S. et al. (2013). Cell. 155, 1409-1421. PubMedID: 24269006
      2. Slobodin, B. et al. (2017). Cell. 169, Issue 2, 326–337. PubMedID: 28388414,

  • Protocols, Manuals & Usage

    • Manuals

      The Product Manual includes details for how to use the product, as well as details of its formulation and quality controls.

  • FAQs & Troubleshooting

  • Citations & Technical Literature

  • Quality, Safety & Legal

    • Quality Control Assays

      Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

    • Specifications & Change Notifications

      The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

    • Certificate of Analysis

      The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

    • Safety Data Sheets

      The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

    • Legal and Disclaimers

      Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

      This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

      New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.

      Licenses

      N6-Methyladenosine Antibody is produced by Cell Signaling Technology, Inc. and sold by New England Biolabs, Inc.

      Trademarks

      NEW ENGLAND BIOLABS®, NEBNEXT®, EPIMARK® and PROTOSCRIPT® are registered trademarks of New England Biolabs, Inc.
      ULTRA™ is a trademark of New England Biolabs, Inc.
      ILLUMINA® is a registered trademark of Illumina, Inc.
      EPPENDORF® is a registered trademark of Sigma, Inc.
      iTAQ™ is a trademark of Bio-Rad Laboratories, Inc.
      SYBR® and DYNABEADS® are registered trademarks of Life Technologies Corporation.
      MYONE™ is a trademark of Life Technologies Corporation.

Featured Videos

View Video Library

Other Products You May Be Interested In

Ineligible item added to cart

Based on your Freezer Program type, you are trying to add a product to your cart that is either not allowed or not allowed with the existing contents of your cart. Please review and update your order accordingly If you have any questions, please contact Customer Service at freezers@neb.com or 1-800-632-5227 x 8.

Continue

Choose your country

North America

Europe

Asia-Pacific

If you don't see your country above, please visit our international site

animated golden butterfly flying around

Find a Golden Butterfly for a Chance to Win!

Help us celebrate our 50th anniversary! We have hidden 1,000 golden butterflies and are waiting for you to find them. They can be anywhere that you find NEB! Beginning April 15th, be sure to visit our website and tables at tradeshows and events you are attending. Visit our social media channels frequently for tips on where we have hidden the butterflies – and once you find one, either click or scan the code to be eligible for a 50th anniversary prize pack, as well as a grand prize trip to NEB headquarters in Ipswich, MA!.

Learn More
Remind me next time

Session Expired

You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.

Institution Changed

Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.

Sign in to your NEB account

To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.